Skip to main content

Table 1 Primer sequence.

From: Angiopoietins lack of prognostic significance in ductal mammary carcinoma

  Sense primer F1(5'-3') Antisenes primer ZR(5'-3')
Ang-1 ttctcttcccagaaacttca actgaacctgaccgtacacatctccgactt
Ang-2 tcatggaaaacaacactcag Actgaacctgaccgtacattctgtactgcattctgctg
Ang-3 Gtggctgaagaagctagaga Actgaacctgaccgtacagtctgattctgggccatt
Tie-2 Acaacatagggtcaagcaac actgaacctgaccgtacagatggctataa