Skip to main content

Table 2 Primer sequences for exons 2, 3, & 13

From: Contribution of BRCA1 germline mutation in patients with sporadic breast cancer

BRCA1 EXON PRIMER Sequences(5'-to-3') Product size Tm(°C)
  EXON2 F GGTTGTGATTAGTTCTTTGG 458 51.3
   R GTGTTGAAAAGGAGAGGAGT   53.4
  EXON3 R GAATGAAATGGAGTTGGATT 381 55.81
   F AGGATCGTATTCTCTGCTGT   53.98
  EXON13 R AGAACCAAGGCTCCATAAT 476 54
   F ATTGCATGAATGTGGTTAGA   53.76