Skip to main content
Download PDF

Expression of thromboxane synthase, TBXAS1 and the thromboxane A2 receptor, TBXA2R, in human breast cancer

International Seminars in Surgical Oncology volume 2, Article number: 23 (2005) Cite this article

Abstract

Background

Thromboxane synthase (TxS) metabolizes the cyclooxygenase product, prostaglandin H(2), into thromboxanes. Some of the thromboxanes are known to be biologically active on cancer cells. The aim of the study was to investigate the expression of thromboxane synthases, TBXAS1 and the thromboxane A2 receptor, TBXA2R in a cohort of human breast cancer patients and also to assess their potential clinical relevance.

Methods

Human breast tumour tissues (n = 120) and non-neoplastic mammary tissues (n = 32) were studied. Levels of TBXA2R and TBXAS1 transcripts were quantified using quantitative real-time RT-PCR analysis and correlated with clinical/pathological information including nodal status, grade, prognosis and long term survival (median follow-up period 120 months).

Results

Breast tumour tissue expressed higher levels of TBXA2R compared with normal mammary tissues, although the difference was not statistically significant (p = 0.09). There was no difference between tumour and normal tissues for TBXAS1. However, TBXA2R expression was significantly increased in grade 3 tumours(p = 0.006 vs grade 1), while TBXAS1 was significantly reduced in grade 3 tumours (p = 0.026 vs grade 1 tumours). A similar differential expression pattern was seen in tumours from patients with different prognosis, in that patients with predicted poor prognosis had higher, but not statistically different, levels of TBXA2R, and significantly lower levels of TBXAS1 (p = 0.008). Finally, Kaplan-Meier survival analysis has shown that patients with high levels of TBXA2R had significantly shorter disease free survival (103.8 (79.1–128.5) months) compared with those with low levels (123.7 (112.0–135.3)) months, p = 0.043.

Conclusion

Thromboxane synthases are differentially expressed in human breast cancer. While TBXA2R is highly expressed in aggressive tumours and linked with poor prognosis, TBXAS1 is expressed at significantly low levels in high grade tumours and tumour patients with poor prognosis. TBXA2R thus has a significant prognostic value in clinical breast cancer.

Background

Prostaglandin metabolites (eicosanoids) are known to be selectively active in regulating functions in cells including cancer cells [1, 2]. For example, 12-HETE and 13-HODE have been shown to act as pro- and anti-cancer eicosanoids in a range of cancer cells. Eicosanoids are generated from prostaglandins by specific enzymes, some of which have been shown to be actively involved in the development and progression of cancers [3, 4]. We have previously reported aberrant expression of the other groups of prostaglandin enzymes 5-, 12-, 15 LOX and COX-2 in human breast cancer and have demonstrated a distinct pattern of difference with these enzymes [5].

Thromboxane synthase (TxS) metabolizes the cyclooxygenase product, prostanglandin H(2), into thromboxane A(2) (TXA(2)), which can cause vessel constriction, platelet activation, and aggregation. In human prostate cancer, thromboxane synthase has been found to be weakly expressed or absent in normal differentiated luminal or secretory cells, significantly elevated in less differentiated or advanced prostate tumors, and markedly increased in tumors with perineural invasion [6]. Over-expression of the enzyme in prostate cancer cells increased the cellular motility [6]. The same over expression of TBXA2R has been seen in adenocarcinoma and squamous cell carcinoma of the lung [7].

Thromboxane synthase inhibitors have been shown to induce apoptosis in glioma cells [8]. In a colorectal tumour model, cancer cells transduced with TXA(2) synthase cDNA produced faster growing tumours, an effect that can be reversed by TXA inhibitors [9].

In cancer cells, including breast cancer cells, TBXA2R has been shown not to influence the adhesion of cancer cells to matrix proteins [10]. Interestingly, TBXA2R has been shown to influence angiogenesis in a lung tumour model, potentially by affecting the migration of endothelial cells [11]. Thromboxane synthase has been shown to be associated with metastasis of renal cell carcinoma [12]. Increased expression of TXA synthase enzymes is a feature of differentiated monocytoid leukaemia cell lines [13]. Early studies using thromboxane synthase inhibitors in vivo have failed to show any beneficial effects on metastasis or spread to lymph nodes [14]. Thromboxane (TX) synthase inhibitors and a TBXA2R receptor antagonist have been found to inhibit the formation of metastasis from tail vein injected B16a cells, as well as reduce spontaneous metastasis from subcutaneous B16a and Lewis lung carcinoma tumours [15].

In the current study, we have investigated the level of expression of Thromboxane A synthase 1, TBXAS1 (otherwise known as Cyp5 and TXS) and Thromboxane A2 receptor, TBXA2R, in a cohort of human breast cancer patients. In addition, we have analysed the clinical and prognostic relevance of both enzymes with the clinical outcome of the patients over a 10 year period.

Materials and methods

Tissues and patients

The cohort of breast tissues and patients were as previously described [5, 16], except that the median follow-up for the patients was 120 months. 120 tumour tissues and 32 normal tissues were included in the current study, in which normal tissues were obtained from the same patients with breast tumour but were away from tumour margins. The normal background tissues were free from tumour involvement as confirmed by histological examination. The pathological data, tumour staging, histological types and the initial prognostic index for the patients were previously described and is given in table 1.

Table 1 Clinical and pathological details of the study cohort
Full size table

Tissue processing and extraction of RNA and generation of cDNA

Tissue processing was as we previously reported [17]. Frozen tissues were sectioned using a cryostat and stored at -20°C until use. Over 20 frozen sections from the tissues were homogenised in a RNA extraction solution using a hand held homogeniser to extract total RNA. The concentrations of RNA were quantified using a UV spectrophotometer. 1 μg RNA was used to generate cDNA using a commercially available RT kit (AbGene Laboratories, Essex, England, UK).

Quantitative analysis of thromboxane synthases

The level of thromboxane synthases transcripts from the above prepared cDNA was determined using a real-time quantitative PCR, based on the Amplifluor technology [18–20]. Briefly, Primers were designed using the Beacon Designer software (version 2, Palo Alto, California, USA), to amplify regions of human thromboxane synthases that have no significant overlap with other known sequences and that the amplified products span over at least one intron. Primers for TBXA2R (gene bank accession number U27325) were 5'tcagctcctggggatcat'3 and 5'actgaacctgaccgtacaggtttcgcagcactgtct'3 and for TXA synthase (gene bank accession number NM_030984) 5'caggtgttggttgagaactt'3 and 5'actgaacctgaccgtacatgtcacgtaaaaacagaacg'3. To one of the primer was added an additional sequence, known as the Z sequence (5'actgaacctgaccgtaca'3) which is complementary to the universal Z probe (Intergen Inc., Oxford, England, UK). A Taqman detection kit for β-actin was purchased from Perkin-Elmer. The reaction was carried out using the following: Hot-start Q-master mix (Abgene), 10 pmol of specific forward primer, 1 pmol reverse primer which has the Z sequence, 10 pmol of FAM-tagged probe (Intergen Inc.,), and cDNA from approximate 50 ng RNA. The reaction of was carried out using a IcyclerIQ (Bio-Rad) which equipment with a optic unit that allows an real time detection of 96 reactions, using the following condition: 94°C for 12 minutes, 50 cycles of 94°C for 15 seconds, 55°C for 40 seconds and 72°C for 20 seconds. The levels of the transcripts were generated from a standard that were run together with the samples.

Statistical analysis was carried out using Mann-Whitney U test and the Kruskal-Wallis test and survival analysis using Kaplan-Meier survival curve and Univariate analysis (SPSS12).

Results

Mammary tissues differentially expressed both TBXA2R and TBXAS1

Breast tissues expressed both TBXA2R and TBXAS1, although levels of TBXA2R transcripts tended to be higher than that of TBXAS1 (figure 1). When normal mammary tissues and tumour tissues were compared, TBXA2R was found to be higher in tumour tissues than in normal tissues, although this is not statistically significant (p = 0.09). The levels of TBXAS1 transcript were identical between normal and tumour tissues (figure 1 left).

Figure 1
figure 1

Levels of TBXA2R (left) and TBXAS1 (right) in mammary tissues.

Full size image

TBXA2R and TBXAS1 transcript levels are differentially linked to tumour differentiation

In the current study, we have observed that there was significant correlation between levels of TBXA2R and TBXAS1 and tumour grade. As revealed in figure 2 (left), grade 2 and grade 3 tumours had significantly higher levels of TBXA2R transcript (p = 0.0158 and p = 0.006 vs grade 1, respectively). Grade 3 tumour had significantly lower levels of TBXAS1 compared with grade 1 tumours (p = 0.026). The difference between grade 1 and grade 2 was not significant.

Figure 2
figure 2

Levels of TBXA2R (left) and TBXAS1 (right) and their relationship with tumour grade. * p < 0.05 vs grade 1.

Full size image

When levels were compared between node positive and node negative tumours, no significant difference was seen with either enzyme (5189 ± 2244 vs 13222 ± 10821 p = 0.48, and 33.2 ± 10 vs 18.5 ± 6.3, p = 0.21, for TBXA2R and TBXAS1, respectively).

The levels of both molecules were also analysed against ER status, based on a recent study [21]. As shown in table 2, ER positive tumours had significantly higher levels of TBXA2R compared with ER negative tumours (p=0.0128). No significant difference was seen with TBXAS1 in different ER status. We also compared the two major histological types of breast tumours in the current study, namely ductal and lobular tumours. As shown in table 3, no significant difference was seen between different types.

Table 2 TBXA2R and TBXAS1 levels and ER status
Full size table
Table 3 TBXA2R and TBXAS1 levels and relationship with histological types
Full size table

Thromboxane synthase levels, prognosis and clinical outcomes

In the current study, we have used two methods in assessing the prognosis and clinical outcome. The first method was using a predictive indicator, the Nottingham Prognostic Index (NPI). Patients were divided into three different prognostic groups, those with predicted good prognosis (NPI1<3.4), moderate (NPI2 3.4–5.4) and poor prognosis (NPI3>5.4). As shown in table 1, patients with predicted poor prognosis had high levels of TBXA2R, however, the difference was not significant. It is noteworthy that the levels of TBXAS1 transcript were significantly lower in patients with predicted poor prognosis (table 4).

Table 4 TBXA2R and TBXAS1 levels and prognosis.
Full size table

The second method was to compare levels of the enzyme transcript based on the clinical outcomes of the patients, over a 10 year follow-up. This resulted in a sub division of patients into two groups:- those who remained disease free or who developed metastasis or local recurrence, and those who died of breast cancer (excluding non-cancer related deaths). As shown in table 5, although a high level of TBXA2R was seen in patients who died of breast cancer, this was not significant. No significant differences in TBXA2R and TBXAS1 transcript were seen between groups with difference clinical outcomes.

Table 5 TBXA2R and TBXAS1 levels and the clinical outcome.
Full size table

Thromboxane synthase and long term survival

The value of TBXA2R and TBXAS1 in assessing long term survival was analysed using the Kaplan-Meier survival and Univariate analysis. As seen in figure 3A, high levels of TBXA2R transcript was associated with a significantly shorter disease free survival (103.8 (79.1–128.5) months vs 123.7 (112.0–135.3) month, for patients with high and low levels, respectively, p = 0.043). There was no significant correlation between TBXA2R and the overall survival (figure 3B), 111.8 (84–139.3) vs 126.1 (115.5–136.7) months, for patients with high and low TBXA2R, p = 0.43, figure 3B). The comparison for the subgroups with different levels of TBXAS1 returned no significant difference for the overall survival (p = 0.43) and disease free survival (p = 0.412).

Figure 3
figure 3

TBXA2R and long term disease free (A) and overall (B) survival. High TBXA2R levels were associated with significant shorter disease free survival (A), p = 0.043.

Full size image

Discussion

The current study has reported that in human breast cancer, transcript levels of thromboxane synthases are aberrant. While TBXA2R is normally expressed in tumours and particularly in aggressive tumours, TBXAS1, however, showed a very different expression pattern from that of TBXA2R. Furthermore, TBXA2R levels are associated with disease free survival.

High levels of TBXA2R and TBXA2Rs have been previously reported in various tumours including prostate, glioma, and melanoma. As a result, previous studies have shown that inhibitors/antagonists to TBXA2R are able to inhibit metastatic spread. In a liver metastasis model from colon cancer, the thromboxane synthase inhibitor, sodium ozagrel at a dose of 15 mg/kg body weight, has been shown to significantly reduce the rate of metastatic tumours in the liver, by 57% [22]. Ketoconazole has been shown to act as an antagonist to both thromboxane synthase and 5-LOX [23]. Ketoconazole has been shown to reduce lung metastasis from melanoma cells in an in vivo model. This together with the current study indicates that TBXA2R, has a potential impact, via its metabolised product TAX2, on the metastatic nature of cancer cells.

Metastasis is a complex biological and clinical phenomenon that involves a number of highly independent yet crucial steps during its development. Thromboxane synthase has been shown to influence a number of steps in the process including cell migration, angiogenesis and apoptosis. Certain eicosanoids (i.e. PGE2) may also stimulate oestrogen synthesis and contribute to the growth of breast tumours, via pathways including that of aromatase [24, 25]. In addition, eicosanoids also interplay with other lipids, by way of the peroxisome proliferators activated receptors (PPAR) [26] which are known to be aberrantly expressed in breast cancer [19].

The level of expression of thromboxane synthase in glioma cells appears to correlate with the speed of migration [27]. Similarly, TBXA2R expression has been shown to influence endothelial cell migration and angiogenesis [11]. Nevertheless, anomalies exist as some inhibitors to thrombaxane synthase, such as dazmegrel, failed to impact on the growth and weight of fibrosarcoma [28, 29].

The other noteworthy observation that can be derived from the current study is the expression pattern of TBXAS1, which is in clear contrast to that of TBXA2R. TBXAS1 is expressed at significantly low levels in high grade tumours (grade 3) and in patients with predicted poor clinical outcome (prognostic index NPI greater than 5.4). This indicates that metabolites generated by TBXAS1 may play a very different role in cancer to that of TBXA2R. There is very little experimental data available on this aspect. Future studies on the TBXAS1 in vitro and in vivo would be of significant interest. Finally, the current study has shown that ER positive tumours have significantly higher TBXA2R levels than ER negative tumours. Given the ongoing interest in COX-2 inhibitors and aromatase inhibitors [30, 31], it would be of interest to take into consideration of TBXA2R, ER status as well as aromatase expression profile, when considering trial design and choice of therapies.

A number of factors are known to regulate the expression of TXA synthases. Factors upregulating thromboxane synthase include phorbol ester [34], Activin A [32], Benzoquinone derivatives [33] which are interesting as some of the compounds are dually active on TBXA2R and 5-LOX. Expression of thromboxane synthase is regulated by cis-elements, trans-activators and potentially by genomic methylation [35]. These early observations have an important bearing when considering the current results.

In conclusion, expression of thromboxane synthases in clinical human breast cancer is aberrant. While TBXA2R is commonly expressed in tumours and particularly in aggressive tumours, TBXAS1, in contrast, showed a very different expression pattern from that of TBXA2R. Furthermore, TBXA2R levels are associated with disease free survival, indicating that the receptor is a prognostic factor in clinical breast cancer.

Abbreviations

12-HETE:

12-hydroxyeicosatetraenoic acid

13-HODE:

13- hydroxyoctadecadienoic acid

COX-2:

cyclooxygenase-2

ER:

oestrogen receptor

LOX:

lipoxygenase

PGE2:

prostaglandin E2

TBXA2R:

thromboxane A2 receptor

TBXAS1:

thromboxane A synthase 1

TXA2:

thromboxane A2

TxS:

Thromboxane synthase

References

  1. Karmali RA, Choi K, Otter G, et al: Eicosanoids and metastasis. Experimental aspects in Lewis lung carcinoma. Cancer Biochem Biophys. 1986, 9: 97-104.

    CAS  PubMed  Google Scholar 

  2. Horrobin DF: Nutritional and medical importance of γ-linolenic acid. Prog Lipid Res. 1992, 31: 163-94. 10.1016/0163-7827(92)90008-7.

    Article  CAS  PubMed  Google Scholar 

  3. Honn KV, Timar J, Rozhin J, Bazaz R, Sameni M, Ziegler G, Sloane BF: A lipoxygenase metabolite, 12-(s)-HETE, stimulates protein-kinase c-mediated release of cathepsin-b from malignant-cells. Exp Cell Res. 1994, 214: 120-130. 10.1006/excr.1994.1240.

    Article  CAS  PubMed  Google Scholar 

  4. Horrobin DF: Essential fatty acids, lipid peroxidation, and cancer. 'omega-6 essential fatty acids'. Edited by: Horrobin DF. 1990, Wiley-Liss, New York, 351-378.

    Google Scholar 

  5. Jiang WG, Douglas-Jones A, Mansel RE: Level of expression of lipoxygenase-5, 12, and 15 and cyclooxygenase in human breast cancer. Prostaglandin Leukotr Ess Fatty Acids. 2003, 69: 275-281. 10.1016/S0952-3278(03)00110-8.

    Article  CAS  Google Scholar 

  6. Nie D, Che M, Zacharek A, Qiao Y, Li L, Li X, Lamberti M, Tang K, Cai Y, Guo Y, Grignon D, Honn KV: Differential expression of thromboxane synthase in prostate carcinoma: role in tumor cell motility. Am J Pathol. 2004, 164: 429-39.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  7. Ermert L, Dierkes C, Ermert M: Immunohistochemical expression of cyclooxygenase isoenzymes and downstream enzymes in human lung tumors. Clin Cancer Res. 2003, 9 (5): 1604-10.

    CAS  PubMed  Google Scholar 

  8. Kurzel F, Hagel Ch, Zapf S, Meissner H, Westphal M, Giese A: Cyclo-oxygenase inhibitors and thromboxane synthase inhibitors differentially regulate migration arrest, growth inhibition and apoptosis in human glioma cells. Acta Neurochir (Wien). 2002, 144 (1): 71-87. 10.1007/s701-002-8276-9.

    Article  CAS  Google Scholar 

  9. Pradono P, Tazawa R, Maemondo M, Tanaka M, Usui K, Saijo Y, Hagiwara K, Nukiwa T: Gene transfer of thromboxane A(2) synthase and prostaglandin I(2) synthase antithetically altered tumor angiogenesis and tumor growth. Cancer Res. 2002, 1;62 (1): 63-6.

    Google Scholar 

  10. Kleber A, Hartmann RW, Jose J: No effect of thromboxane A2 on the attachment of tumor cell lines MDA MB 231, DU145, and U937 to the basement membrane in an in-vitro model. Cancer Res Clin Oncol. 2001, 127 (12): 751-4.

    CAS  Google Scholar 

  11. Nie D, Lamberti M, Zacharek A, Li L, Szekeres K, Tang K, Chen Y, Honn KV: Thromboxane A(2) regulation of endothelial cell migration, angiogenesis, and tumor metastasis. Biochem Biophys Res Commun. 2000, 7;267 (1): 245-51. 10.1006/bbrc.1999.1840.

    Article  Google Scholar 

  12. Bryant J: Correlation between metastatic patterns in renal cell carcinoma and tissue distribution of thromboxane synthetase. Acta Oncol. 1994, 33 (6): 708-9.

    CAS  PubMed  Google Scholar 

  13. Sanduja SK, Mehta K, Xu XM, Hsu SM, Sanduja R, Wu KK: Differentiation-associated expression of prostaglandin H and thromboxane A synthases in monocytoid leukemia cell lines. Blood. 1991, 15;78 (12): 3178-85.

    Google Scholar 

  14. Stamford IF, Melhuish PB, Carroll MA, Corrigan CJ, Patel S, Bennett A: Survival of mice with NC carcinoma is unchanged by drugs that are thought to inhibit thromboxane synthesis or increase prostacyclin formation. Br J Cancer. 1986, 54 (2): 257-63.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  15. Honn KV: Inhibition of tumor cell metastasis by modulation of the vascular prostacyclin/thromboxane A2 system. Clin Exp Metastasis. 1983, 1 (2): 103-14. 10.1007/BF00121490.

    Article  CAS  PubMed  Google Scholar 

  16. Watkins G, Douglas-Jones A, Bryce R, Mansel RE, Jiang WG: Expression of osteonectin (SPARC) in human breast cancer. Prostaglandins Leukotriences and Essential Fatty Acids. 2005, 72: 267-272. 10.1016/j.plefa.2004.12.003.

    Article  CAS  Google Scholar 

  17. Jiang WG, Watkins G, Lane J, Douglas-Jones A, Cunnick GH, Mokbel M, Mansel RE: Prognostic value of Rho familty and and rho-GDIs in breast cancer. Clinical Cancer Research. 2003, 9 (17): 6432-6440.

    CAS  PubMed  Google Scholar 

  18. Jiang WG, Watkins G, Fodstad O, Douglas-Jones A, Mokbel K, Mansel RE: Differential expression of the CCN family members Cyr61 from CTGF and Nov in human breast cancer. Endocrine Related Cancers. 2004, 11: 781-791. 10.1677/erc.1.00825.

    Article  CAS  Google Scholar 

  19. Jiang WG, Douglas-Jones A, Mansel RE: Level of expression of PPAR-gamma and its co-activator (PPAR-GCA) in human breast cancer. International Journal of Cancer. 2003, 106: 752-757. 10.1002/ijc.11302.

    Article  CAS  Google Scholar 

  20. Jiang WG, Davies G, Martin TA, Parr C, Watkins G, Mason MD, Mokbel K, Mansel RE: Molecular targeting of matrilysin and its impact on tumour growth in vivo, the potential implications in breast cancer therapy. Clinical Cancer Research. 2005, 11 (16): 6012-6019. 10.1158/1078-0432.CCR-05-0275.

    Article  CAS  PubMed  Google Scholar 

  21. Jiang WG, Watkins G, Douglas-Jones A, Mokbel K, Mansel RE, Fodstad O: Expression of Com-1/P8 in human breast cancer and its relevance to clinical outcome and ER status. International Journal of Cancer. 2005, 117: 730-737. 10.1002/ijc.21221.

    Article  CAS  Google Scholar 

  22. Yokoyama I, Hayashi S, Kobayashi T, Negita M, Yasutomi M, Uchida K, Takagi H: Prevention of experimental hepatic metastasis with thromboxane synthase inhibitor. Res Exp Med (Berl). 1995, 195 (4): 209-15.

    Article  CAS  Google Scholar 

  23. Nardone PA, Slotman GJ, Vezeridis MP: Ketoconazole: a thromboxane synthetase and 5-lipoxygenase inhibitor with antimetastatic activity in B16-F10 melanoma. J Surg Res. 1988, 44 (4): 425-9. 10.1016/0022-4804(88)90185-0.

    Article  CAS  PubMed  Google Scholar 

  24. Zhao Y, Agarwal VR, Mendelson CR, Simpson ER: Estrogen biosynthesis proximal to a breast tumor is stimulated by PGE2 via cyclic AMP, leading to activation of promoter II of the CYP19 (aromatase) gene. Endocrinology. 1996, 137: 5739-42. 10.1210/en.137.12.5739.

    CAS  PubMed  Google Scholar 

  25. Brodie AM, Lu Q, Long BJ, Fulton A, Chen T, Macpherson N, DeJong PC, Blankenstein MA, Nortier JW, Slee PH, van de Ven J, van Gorp JM, Elbers JR, Schipper ME, Blijham GH, Thijssen JH: Aromatase and COX-2 expression in human breast cancers. J Steroid Biochem Mol Biol. 2001, 79: 41-7. 10.1016/S0960-0760(01)00131-5.

    Article  CAS  PubMed  Google Scholar 

  26. Rubin GL, Zhao Y, Kalus AM, Simpson ER: Peroxisome proliferator-activated receptor gamma ligands inhibit estrogen biosynthesis in human breast adipose tissue: possible implications for breast cancer therapy. Cancer Res. 2000, 60: 1604-8.

    CAS  PubMed  Google Scholar 

  27. Giese A, Hagel C, Kim EL, Zapf S, Djawaheri J, Berens ME, Westphal M: Thromboxane synthase regulates the migratory phenotype of human glioma cells. Neuro-oncol. 1999, 1 (1): 3-13. 10.1215/S1522851798000143.

    PubMed Central  CAS  PubMed  Google Scholar 

  28. Chiabrando C, Broggini M, Castelli MG, Cozzi E, Castagnoli MN, Donelli MG, Garattini S, Giavazzi R, Fanelli R: Prostaglandin and thromboxane synthesis by M5076 ovarian reticulosarcoma during growth: effects of a thromboxane synthetase inhibitor. Cancer Res. 1987, 15;47 (4): 988-91.

    Google Scholar 

  29. Davies G, Martin LA, Sacks N, Dowsett M: Cyclooxygenase-2 (COX-2), aromatase and breast cancer: a possible role for COX-2 inhibitors in breast cancer chemoprevention. Ann Oncol. 2002, 13: 669-78. 10.1093/annonc/mdf125.

    Article  CAS  PubMed  Google Scholar 

  30. Goss PE: Breast cancer prevention – clinical trials strategies involving aromatase inhibitors. J Steroid Biochem Mol Biol. 2003, 86: 487-93. 10.1016/S0960-0760(03)00378-9.

    Article  CAS  PubMed  Google Scholar 

  31. Vicenzi E, Lampugnani MG, Bolognese Dalessandro AP, Niewiarowska A, de Gaetano G, Donati MB: Dissociation between thromboxane generation and metastatic potential in cells from a murine fibrosarcoma. Studies with a selective thromboxane synthase inhibitor. Int J Cancer. 1987, 15;39 (4): 488-91.

    Article  Google Scholar 

  32. Yamashita T, Shimizu T, Ogata E: Activin A/erythroid differentiation factor induces thromboxane A2 synthetic activity in murine erythroleukemia cells. J Biol Chem. 1991, 25;266 (6): 3888-92.

    Google Scholar 

  33. Ohkawa S, Terao S, Terashita Z, Shibouta Y, Nishikawa K: Dual inhibitors of thromboxane A2 synthase and 5-lipoxygenase with scavenging activity of active oxygen species. Synthesis of a novel series of (3-pyridylmethyl)benzoquinone derivatives. J Med Chem. 1991, 34 (1): 267-76. 10.1021/jm00105a042.

    Article  CAS  PubMed  Google Scholar 

  34. Ihara H, Yokoyama C, Miyata A, Kosaka T, Nusing R, Ullrich V, Tanabe T: Induction of thromboxane synthase and prostaglandin endoperoxide synthase mRNAs in human erythroleukemia cells by phorbol ester. FEBS Lett. 1992, 20;306 (2–3): 161-4. 10.1016/0014-5793(92)80990-X.

    Article  Google Scholar 

  35. Lee KD, Baek SJ, Shen RF: Multiple factors regulating the expression of human thromboxane synthase gene. Biochem J. 1996, 1;319 (Pt 3): 783-91.

    Article  Google Scholar 

Download references

Acknowledgements

WGJ acknowledge Cancer Research Wales and Cancer Research UK for support.

Author information

Authors and Affiliations

  1. Metastasis & Angiogenesis Research Group, Wales College of Medicine, Cardiff University, Cardiff, UK

    Gareth Watkins, Anthony Douglas-Jones, Robert E Mansel & Wen G Jiang

Authors
  1. Gareth Watkins
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Anthony Douglas-Jones
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Robert E Mansel
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Wen G Jiang
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Wen G Jiang.

Additional information

Competing interests

The author(s) declare that they have no competing interest.

Authors' contributions

GW: conducting experiments, data analysis and manuscript preparation.

REM: study design, sample collection and MS preparation.

ADJ: Histological analysis.

WEJ: study design, experimental design, data analysis, MS preparation.

Authors’ original submitted files for images

Rights and permissions

Open Access This is an open access article distributed under the terms of the Creative Commons Attribution Noncommercial License ( https://creativecommons.org/licenses/by-nc/2.0 ), which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.

Reprints and permissions

About this article

Cite this article

Watkins, G., Douglas-Jones, A., Mansel, R.E. et al. Expression of thromboxane synthase, TBXAS1 and the thromboxane A2 receptor, TBXA2R, in human breast cancer. Int Semin Surg Oncol 2, 23 (2005). https://doi.org/10.1186/1477-7800-2-23

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/1477-7800-2-23

Keywords

International Seminars in Surgical Oncology

ISSN: 1477-7800